traits introductionlibrary("traits")
Get trait data for Willow (Salix spp.)
(salix <- betydb_search("Salix Vcmax"))
#> # A tibble: 14 x 36
#> checked result_type id citation_id site_id treatment_id sitename
#> <int> <chr> <int> <int> <int> <int> <chr>
#> 1 1 traits 39217 430 645 1342 ""
#> 2 1 traits 39218 430 645 1343 ""
#> 3 1 traits 39219 430 645 1344 ""
#> 4 1 traits 39220 430 645 1345 ""
#> 5 1 traits 25405 51 NA 1 <NA>
#> 6 1 traits 39213 430 645 1342 ""
#> 7 1 traits 39214 430 645 1343 ""
#> 8 1 traits 39215 430 645 1344 ""
#> 9 1 traits 39216 430 645 1345 ""
#> 10 1 traits 39221 430 645 1342 ""
#> 11 1 traits 39222 430 645 1343 ""
#> 12 1 traits 39223 430 645 1344 ""
#> 13 1 traits 39224 430 645 1345 ""
#> 14 1 traits 37519 381 602 1220 <NA>
#> # … with 29 more variables: city <chr>, lat <dbl>, lon <dbl>,
#> # scientificname <chr>, commonname <chr>, genus <chr>, species_id <int>,
#> # cultivar_id <int>, author <chr>, citation_year <int>, treatment <chr>,
#> # date <chr>, time <chr>, raw_date <chr>, month <int>, year <int>,
#> # dateloc <chr>, trait <chr>, trait_description <chr>, mean <dbl>,
#> # units <chr>, n <int>, statname <chr>, stat <dbl>, notes <chr>,
#> # access_level <int>, cultivar <chr>, entity <lgl>, method_name <lgl>
# equivalent:
# (out <- betydb_search("willow"))
Summarise data from the output data.frame
library("dplyr")
salix %>%
group_by(scientificname, trait) %>%
mutate(.mean = as.numeric(mean)) %>%
summarise(mean = round(mean(.mean, na.rm = TRUE), 2),
min = round(min(.mean, na.rm = TRUE), 2),
max = round(max(.mean, na.rm = TRUE), 2),
n = length(n))
#> # A tibble: 4 x 6
#> # Groups: scientificname [4]
#> scientificname trait mean min max n
#> <chr> <chr> <dbl> <dbl> <dbl> <int>
#> 1 Salix Vcmax 65 65 65 1
#> 2 Salix dasyclados Vcmax 46.1 34.3 56.7 4
#> 3 Salix sachalinensis × miyabeana Vcmax 79.3 79.3 79.3 1
#> 4 Salix viminalis Vcmax 43.0 20.0 61.3 8
Get sequences by id
ncbi_byid(ids = "360040093")
#> taxon
#> 1 Eristalis transversa
#> taxonomy
#> 1 Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Holometabola; Diptera; Brachycera; Muscomorpha; Syrphoidea; Syrphidae; Eristalinae; Eristalini; Eristalis
#> gene_desc
#> 1 Eristalis transversa voucher CNC:Diptera:102013 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
#> organelle gi_no acc_no keyword specimen_voucher
#> 1 mitochondrion 360040093 JN991986.1 BARCODE CNC:Diptera:102013
#> lat_lon
#> 1 38.4623 N 79.2417 W
#> country
#> 1 USA: Virginia, Reddish Knob Lookout, 14.5km W Briery Branch
#> paper_title
#> 1 The evolution of imperfect mimicry in hover flies (Diptera: Syrphidae)
#> journal first_author uploaded_date length
#> 1 Unpublished Penny,H.D. 03-NOV-2012 658
#> sequence
#> 1 tactttatattttgtatttggaacatgagcgggtatagtaggaacttcattaagaattttaattcgagctgaattaggtcatccaggtgcattaattggtgatgatcaaatttataatgttattgtaacagctcatgcttttgttataattttttttatagtaatacctattataattggaggatttggaaattgattagtaccacttatattaggagctccagatatagcattccctcgaataaataatataagtttctgattattacctccttctttaactctattattagtaagaagtatagtagaaaatggggctggaacaggatgaacagtttatcctccattatcaagtaatattgcacatggaggagcctcagttgatttagcaattttttcacttcacttatcaggaatatcatctattttaggtgcagtaaattttattacaacagttattaatatacgatcaacaggaattacttatgatcgtatacctttatttgtttgatctgttgctattacagctttattattattattatcattaccagtactagcaggagctattacaatattattaactgatcgaaatttaaatacatcattctttgatccagcaggaggaggagaccctatcctgtaccaacacttattc
Get sequences searching by taxonomic name
out <- ncbi_searcher(taxa = "Umbra limi", seqrange = "1:2000")
#> ══ 1 queries ═══════════════
#> ✔ Found: Umbra+limi
#> ══ Results ═════════════════
#>
#> ● Total: 1
#> ● Found: 1
#> ● Not Found: 0
head(out)
#> taxon length
#> 1 Umbra limi 761
#> 2 Umbra limi 765
#> 3 Umbra limi 764
#> 4 Umbra limi 743
#> 5 Umbra limi 758
#> 6 Umbra limi 653
#> gene_desc
#> 1 Umbra limi voucher NXG2012264 rhodopsin (Rho) gene, partial cds
#> 2 Umbra limi voucher NXG201250 rhodopsin (Rho) gene, partial cds
#> 3 Umbra limi voucher NXG2012183 rhodopsin (Rho) gene, partial cds
#> 4 Umbra limi voucher NXG201252 rhodopsin (Rho) gene, partial cds
#> 5 Umbra limi voucher NXG2012231 rhodopsin (Rho) gene, partial cds
#> 6 Umbra limi voucher NXG201250 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
#> acc_no gi_no
#> 1 KX146134 1049488959
#> 2 KX146015 1049488721
#> 3 KX145969 1049488629
#> 4 KX145777 1049488245
#> 5 KX145759 1049488209
#> 6 KX145415 1049487591
traitbank(query = "MATCH (n:Trait) RETURN n LIMIT 1;")
#> $columns
#> [1] "n"
#>
#> $data
#> $data[[1]]
#> metadata.id metadata.labels
#> 1 20280619 Trait
#> paged_traverse
#> 1 http://10.252.248.44:7474/db/data/node/20280619/paged/traverse/{returnType}{?pageSize,leaseTime}
#> outgoing_relationships
#> 1 http://10.252.248.44:7474/db/data/node/20280619/relationships/out
#> outgoing_typed_relationships
#> 1 http://10.252.248.44:7474/db/data/node/20280619/relationships/out/{-list|&|types}
#> labels
#> 1 http://10.252.248.44:7474/db/data/node/20280619/labels
#> create_relationship
#> 1 http://10.252.248.44:7474/db/data/node/20280619/relationships
#> traverse
#> 1 http://10.252.248.44:7474/db/data/node/20280619/traverse/{returnType}
#> all_relationships
#> 1 http://10.252.248.44:7474/db/data/node/20280619/relationships/all
#> all_typed_relationships
#> 1 http://10.252.248.44:7474/db/data/node/20280619/relationships/all/{-list|&|types}
#> property
#> 1 http://10.252.248.44:7474/db/data/node/20280619/properties/{key}
#> self
#> 1 http://10.252.248.44:7474/db/data/node/20280619
#> incoming_relationships
#> 1 http://10.252.248.44:7474/db/data/node/20280619/relationships/in
#> properties
#> 1 http://10.252.248.44:7474/db/data/node/20280619/properties
#> incoming_typed_relationships
#> 1 http://10.252.248.44:7474/db/data/node/20280619/relationships/in/{-list|&|types}
#> data.eol_pk data.resource_pk
#> 1 R74-PK5014587 110690
#> data.scientific_name
#> 1 <i>Adenopodia floribunda</i> (Kleinhoonte) Brenan
#> data.source
#> 1 http://www.pnas.org/content/114/40/10695
#> data.literal
#> 1 http://eol.org/schema/terms/Tropical_and_subtropical_moist_broadleaf_forests
Get the species list and their ids
coral_species()
#> # A tibble: 1,548 x 2
#> name id
#> <chr> <chr>
#> 1 Acanthastrea brevis 3
#> 2 Acanthastrea echinata 4
#> 3 Acanthastrea hemprichi 6
#> 4 Acanthastrea ishigakiensis 8
#> 5 Acanthastrea regularis 12
#> 6 Acanthastrea rotundoflora 13
#> 7 Acanthastrea subechinata 14
#> 8 Acropora abrolhosensis 16
#> 9 Acropora abrotanoides 17
#> 10 Acropora aculeus 18
#> # … with 1,538 more rows
Get data by taxon
coral_taxa(80)
#> # A tibble: 3,540 x 25
#> observation_id access user_id specie_id specie_name location_id
#> <int> <int> <int> <int> <chr> <int>
#> 1 157133 1 10 80 Acropora h… 1
#> 2 156961 1 14 80 Acropora h… 409
#> 3 5781 1 1 80 Acropora h… 1
#> 4 156610 1 2 80 Acropora h… 500
#> 5 158118 1 10 80 Acropora h… 409
#> 6 119211 1 49 80 Acropora h… 1
#> 7 158211 1 10 80 Acropora h… 413
#> 8 90294 1 15 80 Acropora h… 341
#> 9 90294 1 15 80 Acropora h… 341
#> 10 90294 1 15 80 Acropora h… 341
#> # … with 3,530 more rows, and 19 more variables: location_name <chr>,
#> # latitude <dbl>, longitude <dbl>, resource_id <int>,
#> # resource_secondary_id <int>, measurement_id <int>, trait_id <int>,
#> # trait_name <chr>, standard_id <int>, standard_unit <chr>,
#> # methodology_id <int>, methodology_name <chr>, value <chr>,
#> # value_type <chr>, precision <dbl>, precision_type <chr>,
#> # precision_upper <dbl>, replicates <int>, notes <chr>
Get data by trait
coral_traits(105)
#> # A tibble: 0 x 25
#> # … with 25 variables: observation_id <lgl>, access <lgl>, user_id <lgl>,
#> # specie_id <lgl>, specie_name <lgl>, location_id <lgl>,
#> # location_name <lgl>, latitude <lgl>, longitude <lgl>,
#> # resource_id <lgl>, resource_secondary_id <lgl>, measurement_id <lgl>,
#> # trait_id <lgl>, trait_name <lgl>, standard_id <lgl>,
#> # standard_unit <lgl>, methodology_id <lgl>, methodology_name <lgl>,
#> # value <lgl>, value_type <lgl>, precision <lgl>, precision_type <lgl>,
#> # precision_upper <lgl>, replicates <lgl>, notes <lgl>
Habitat data
birdlife_habitat(22721692)
#> id Habitat (level 1) Habitat (level 2) Importance
#> 1 22721692 Forest Subtropical/Tropical Dry major
#> 2 22721692 Forest Subtropical/Tropical Moist Montane major
#> 3 22721692 Forest Temperate suitable
#> 4 22721692 Shrubland Subtropical/Tropical High Altitude suitable
#> Occurrence
#> 1 breeding
#> 2 non-breeding
#> 3 breeding
#> 4 breeding
Threats data
birdlife_threats(22721692)
#> id threat1
#> 1 22721692 Agriculture & aquaculture
#> 2 22721692 Agriculture & aquaculture
#> 3 22721692 Biological resource use
#> 4 22721692 Climate change & severe weather
#> 5 22721692 Climate change & severe weather
#> 6 22721692 Climate change & severe weather
#> 7 22721692 Invasive and other problematic species, genes & diseases
#> 8 22721692 Invasive and other problematic species, genes & diseases
#> 9 22721692 Invasive and other problematic species, genes & diseases
#> 10 22721692 Invasive and other problematic species, genes & diseases
#> 11 22721692 Invasive and other problematic species, genes & diseases
#> 12 22721692 Invasive and other problematic species, genes & diseases
#> 13 22721692 Natural system modifications
#> 14 22721692 Natural system modifications
#> 15 22721692 Residential & commercial development
#> 16 22721692 Transportation & service corridors
#> threat2
#> 1 Annual & perennial non-timber crops - Agro-industry farming
#> 2 Annual & perennial non-timber crops - Small-holder farming
#> 3 Logging & wood harvesting - Unintentional effects: (subsistence/small scale) [harvest]
#> 4 Droughts
#> 5 Habitat shifting & alteration
#> 6 Storms & flooding
#> 7 Invasive non-native/alien species/diseases - Sus scrofa
#> 8 Invasive non-native/alien species/diseases - Unspecified species
#> 9 Problematic native species/diseases - Dendroctonus frontalis
#> 10 Problematic native species/diseases - Odocoileus virginianus
#> 11 Problematic native species/diseases - Unspecified species
#> 12 Problematic species/disease of unknown origin - Unspecified species
#> 13 Fire & fire suppression - Trend Unknown/Unrecorded
#> 14 Other ecosystem modifications
#> 15 Housing & urban areas
#> 16 Roads & railroads
#> stresses
#> 1 Ecosystem degradation, Ecosystem conversion, Other
#> 2 Ecosystem degradation, Ecosystem conversion, Other
#> 3 Ecosystem degradation
#> 4 Ecosystem degradation
#> 5 Ecosystem degradation, Ecosystem conversion
#> 6 Ecosystem degradation
#> 7 Ecosystem degradation, Ecosystem conversion
#> 8 Species mortality
#> 9 Ecosystem degradation
#> 10 Ecosystem degradation
#> 11 Ecosystem degradation, Reduced reproductive success
#> 12 Species mortality
#> 13 Ecosystem degradation, Ecosystem conversion
#> 14 Ecosystem degradation, Ecosystem conversion
#> 15 Ecosystem degradation, Ecosystem conversion, Species mortality, Other
#> 16 Species mortality
#> timing
#> 1 Agriculture & aquaculture
#> 2 Agriculture & aquaculture
#> 3 Biological resource use
#> 4 Climate change & severe weather
#> 5 Climate change & severe weather
#> 6 Climate change & severe weather
#> 7 Invasive and other problematic species, genes & diseases
#> 8 Invasive and other problematic species, genes & diseases
#> 9 Invasive and other problematic species, genes & diseases
#> 10 Invasive and other problematic species, genes & diseases
#> 11 Invasive and other problematic species, genes & diseases
#> 12 Invasive and other problematic species, genes & diseases
#> 13 Natural system modifications
#> 14 Natural system modifications
#> 15 Residential & commercial development
#> 16 Transportation & service corridors
#> scope
#> 1 Annual & perennial non-timber crops - Agro-industry farming
#> 2 Annual & perennial non-timber crops - Small-holder farming
#> 3 Logging & wood harvesting - Unintentional effects: (subsistence/small scale) [harvest]
#> 4 Droughts
#> 5 Habitat shifting & alteration
#> 6 Storms & flooding
#> 7 Invasive non-native/alien species/diseases - Sus scrofa
#> 8 Invasive non-native/alien species/diseases - Unspecified species
#> 9 Problematic native species/diseases - Dendroctonus frontalis
#> 10 Problematic native species/diseases - Odocoileus virginianus
#> 11 Problematic native species/diseases - Unspecified species
#> 12 Problematic species/disease of unknown origin - Unspecified species
#> 13 Fire & fire suppression - Trend Unknown/Unrecorded
#> 14 Other ecosystem modifications
#> 15 Housing & urban areas
#> 16 Roads & railroads
#> severity impact
#> 1 Ongoing Ongoing
#> 2 Ongoing Ongoing
#> 3 Ongoing Ongoing
#> 4 Ongoing Ongoing
#> 5 Future Future
#> 6 Ongoing Ongoing
#> 7 Ongoing Ongoing
#> 8 Ongoing Ongoing
#> 9 Ongoing Ongoing
#> 10 Ongoing Ongoing
#> 11 Ongoing Ongoing
#> 12 Ongoing Ongoing
#> 13 Ongoing Ongoing
#> 14 Future Future
#> 15 Ongoing Ongoing
#> 16 Ongoing Ongoing